Community Profile


Hyeokjin Jho

Last seen: 10 days ago
20 total contributions since 2018

Hyeokjin Jho's Badges

  • 3 Month Streak
  • Knowledgeable Level 1
  • Personal Best Downloads Level 1
  • Revival Level 1
  • First Submission
  • First Answer
  • Thankful Level 1
  • Solver

View details...

Contributions in
View by


How does clearing nested function workspace works?
I found that this code works : function main message = 'hello world!'; figure; uicontrol('style','pushbutton',.....

23 days ago | 1 answer | 0



Index in position 2 exceeds array bounds
Since n = 4, for(j=1:1:n-1) will make j from 1 to 3. However pos is 4x2 matrix. When j is 3, pos(1,j) refers outside of the mat...

3 months ago | 0

What do the pixelIdxlist mean?
Let's say your image input for bwconncomp is BW. i.e. CC = bwconncomp(BW); Then CC.pixelIdxList{i} is linear indices of i-th i...

3 months ago | 0

Visualization of data in 3 dimention.
F=5:1:50; % total 46 value w=2*pi*F; S=0:1:100;%total 101 value [wM,SM]=meshgrid(w,S); P = SM./wM; surf(w,S,P) You can c...

3 months ago | 1

| accepted

comparing pixels in 3x3 block
Assuming your matrix is A % collect green pixels query_right = A(2:end-1,3:end); query_left = A(2:end-1,1:end-2); query_dow...

5 months ago | 1

| accepted


draws surf plot with errorbar

5 months ago | 7 downloads |


How do I add error bars in the Z-axis to a surface plot? try this

6 months ago | 0


Collapsing preallocated memory of sparse matrix
I used sparse matrix for some calculation, and I roughly know how many nnz will be stored. So I preallocated a slightly larger m...

1 year ago | 1 answer | 1




nargout for methods, and inherited methods

1 year ago | 1 download |


Is there any way to set function (or method) output as comma separated list?
If we have an array of struct, like this: s(1).a = 1; s(2).a = 2; s(3).a = 3; and then if we get the field of this...

1 year ago | 1 answer | 0



Need help with my function (Basic Question)
Putting |message| inside |if| statement is better. And also I found some mistake in the inequality signs. if 0<= pH && pH...

1 year ago | 0

Matrix Manipulation of a specific column
Assuming |Data| is the matrix that containing your data, threshold = 10; for i = size(Data,2) pickedColumn = ...

1 year ago | 0


How to get all possible rearrange permutations of array with repeated elements?
I have some DNA sequences to rearrange 'ACTCACATCTGGTTCCTCTA' and I need all possible permutations of this (4 'A', 7 'T'...

1 year ago | 1 answer | 0




Find all elements less than 0 or greater than 10 and replace them with NaN
Given an input vector x, find all elements of x less than 0 or greater than 10 and replace them with NaN. Example: Input ...

2 years ago


Column Removal
Remove the nth column from input matrix A and return the resulting matrix in output B. So if A = [1 2 3; 4 5 6]; and ...

2 years ago


Determine if input is odd
Given the input n, return true if n is odd or false if n is even.

2 years ago


Add two numbers
Given a and b, return the sum a+b in c.

2 years ago


Find the sum of all the numbers of the input vector
Find the sum of all the numbers of the input vector x. Examples: Input x = [1 2 3 5] Output y is 11 Input x ...

2 years ago


Times 2 - START HERE
Try out this test problem first. Given the variable x as your input, multiply it by two and put the result in y. Examples:...

2 years ago


Make the vector [1 2 3 4 5 6 7 8 9 10]
In MATLAB, you create a vector by enclosing the elements in square brackets like so: x = [1 2 3 4] Commas are optional, s...

2 years ago