Community Profile

photo

lilly lord


Last seen: 1 day ago
15 total contributions since 2020

lilly lord's Badges

  • Thankful Level 2
  • First Review

View details...

Contributions in
View by

Question


How to permute binary numbers to a specific permutation
Hi I have numbers in binary form. I want to permute to 1 digit to right so that a new binary value is created. 0 F=[0 6 2 5 4...

2 days ago | 1 answer | 0

1

answer

Question


Row and Column permutation of a matrix
Hi I want to permute each row and column of the matrix using specified permutation e.g %%%%%Permute each row by a certain perm...

22 days ago | 1 answer | 0

1

answer

Question


Error in If else statement
Hi I am getting error in if else statement but dont know where is the mistake. Points=[]; for i=1:257 if i == 16 & i =...

22 days ago | 1 answer | 0

1

answer

Question


Generating matrix from another array
I am tring to generate a matrix S1,S2,S3 from an array E3 . All three matrices should contain numbers from 0 to 25 but in the ...

1 month ago | 1 answer | 0

1

answer

Question


How to multiply one elements with rest of the elements in Galois field
Hi, I am working in Galois field, The generated field is GF( 2^4) p=2; n=4; poly=[1 1 0 0 1]; field1=gftuple([-1:p^n-2]',pol...

1 month ago | 0 answers | 0

0

answers

Question


Bit xor of row with the next row and the output is again xored with the next row
Hi, I have a image and I want to xor first row with single number then Xor 2nd row with first, the output is xored aith the next...

4 months ago | 1 answer | 0

1

answer

Question


Bit xor of two binary strings and conversion into decimal
Hi, I have two large binary strings (e.g 256 bits each), then how to perform bit Xor operation and then convert the answer into...

4 months ago | 2 answers | 0

2

answers

Question


Dna encoding rule1
Hi I have an issue storing the DNA sequenc using for loop. If some one can help me. x=[2 34 50 21]; [m n]=size(x); mn=m*n; P...

4 months ago | 0 answers | 0

0

answers

Question


Addition of two DNA sequenc
Hi, I have a problem in DNA addition %%%%%%DNA addition P_ DNA1='ACAAGGGTTTAAACCCTTAC'; P_DNA2='TTTTGGGAAATGTGACAT...

4 months ago | 1 answer | 0

1

answer

Question


Binary to DNA sequence conversion
Hi, i have a binary string which I want to convert into DNA sequence. A='010110101010101011100110011111'; [m n]=size(A); mn=m...

4 months ago | 1 answer | 0

1

answer

Question


reverse indexing of a matrix in matlab
Hi I have the code and i want the inverse mapping that is to get back P P=[188 5 95 60;3 59 0 111;255 123 51 84 ]; Ma=[25 222 ...

4 months ago | 1 answer | 0

1

answer

Question


how to extract last 3 bits from binary string and then concatenate
Hi, i have an array which is converted into binary string. I want to extract last three bits and then arrange in an array Y=[12...

5 months ago | 1 answer | 0

1

answer

Question


Permutation according to table
Hi, I have two tables P=[188 5 95 60;3 59 0 111;255 123 51 84]; Ma=[25 222 80 6;100 1 190 97;73 33 254 184]; M_1=[]; for i=1...

5 months ago | 1 answer | 0

1

answer

Question


how to get answer from tic tok command that stays on the screen
Hi, I m using tic toc commamand , but answer appears in commad window for nano sec, i think and then disappears. i have attached...

6 months ago | 1 answer | 0

1

answer

Question


How to get result of cipher after every round using DES
Hello, I am using DES code downloaded from file exchane, I want the output after every round . How to do this. (https://www....

7 months ago | 0 answers | 0

0

answers