Main Content

rnafold

Predict minimum free-energy secondary structure of RNA sequence

collapse all in page

Syntax

rnafold(Seq)
RNAbracket = rnafold(Seq)
[RNAbracket,Energy] = rnafold(Seq)
[RNAbracket,Energy,RNAmatrix] = rnafold(Seq)
___ = rnafold(Seq,Name=Value)

Description

rnafold(Seq) predicts and displays the secondary structure (in bracket notation) associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach.

Note

For long sequences, this prediction can be time consuming. For example, a 600-nucleotide sequence can take several minutes, and sequences greater than 1000 nucleotides can take over 1 hour, depending on your system.

RNAbracket = rnafold(Seq) returns the secondary structure associated with the minimum free energy for the RNA sequence, Seq, using the thermodynamic nearest-neighbor approach. The returned structure, RNAbracket, is in bracket notation, that is a vector of dots and brackets. Each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.

[RNAbracket,Energy] = rnafold(Seq) returns Energy, the energy value (in kcal/mol) of the minimum free-energy secondary structure of the RNA sequence.

[RNAbracket,Energy,RNAmatrix] = rnafold(Seq) returns RNAmatrix, a connectivity matrix representing the secondary structure associated with the minimum free energy. RNAmatrix is an upper triangular matrix where RNAmatrix(i, j) = 1 only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.

___ = rnafold(Seq,Name=Value) specifies options using one or more name-value arguments in addition to the input arguments in previous syntaxes. Each name-value argument is case insensitive.

example

Examples

collapse all

Open Live Script

This example shows how to determine the minimum free-energy secondary structure (in both bracket and matrix notation) and the energy value of the 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA' RNA sequence.

seq = 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA';
[bracket,energy,matrix] = rnafold(seq);
bracket
bracket = 
'..(((((...((....))...))))).....'

Input Arguments

collapse all

RNA sequence, specified as a character vector, string, or MATLAB structure.

Example: 'ACCCCCUCCUUCCUUGGAUCAAGGGGCUCAA'

Data Types: char | string

Name-Value Arguments

Specify optional pairs of arguments as Name1=Value1,...,NameN=ValueN, where Name is the argument name and Value is the corresponding value. Name-value arguments must appear after other arguments, but the order of the pairs does not matter.

Example: MinLoopSize=3

Minimum size of the loops (in bases) to be considered when computing free energy, specified as an integer.

Example: MinLoopSize=3

Data Types: single | double

Prevent GU or UG pairs from forming, specified as false or true. Specify true to allow GU and UG pairs to form.

Example: NoGU='true'

Control display of progress bar during the computation of the minimum free-energy secondary structure, specified as false or true. Specify true to show progress bar.

Example: Progress='false'

Output Arguments

collapse all

Bracket notation for minimum-free energy secondary structure of RNA sequence, returned as a bracket of dots and brackets indicating the bracket notation. In the bracket notation, each dot represents an unpaired base, while a pair of equally nested, opening and closing brackets represents a base pair.

Energy of minimum free-energy secondary structure of RNA sequence in kcal/mol, returned as a scalar.

Connectivity matrix representing the minimum free-energy secondary structure of an RNA sequence, returned as a binary, upper-triangular matrix, where RNAmatrix(i, j) = 1. if and only if the ith residue in the RNA sequence Seq is paired with the jth residue of Seq.

References

[1]

[2] Wuchty, S., Fontana, W., Hofacker, I., and Schuster, P. (1999). Complete suboptimal folding of RNA and the stability of secondary structures. Biopolymers 49, 145–165.

[3] Matthews, D., Sabina, J., Zuker, M., and Turner, D. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288, 911–940.

Version History

Introduced in R2007b

See Also

|